Filtyp
Recently the Intergovernmental Panel on Climate Change released their 6th Assessment reports which confirm that the impact of climate change is visible, e.g. through an increased weather volatility leading both to hotter drier weather and increased flooding in some regions globally. One clear example of this is the increased prevalence of wildfires in recent years and increasing wildfire potential
There is a lack of objective evaluative standards for academic work. While this has been recognized in studies of how gatekeepers pass judgment on the works of others, little is known about how scholars deal with the uncertainty about how their work will be evaluated by gatekeepers. Building upon 35 interviews with early career academics in political science and history, this paper explores how juThere is a lack of objective evaluative standards for academic work. While this has been recognized in studies of how gatekeepers pass judgment on the works of others, little is known about how scholars deal with the uncertainty about how their work will be evaluated by gatekeepers. Building upon 35 interviews with early career academics in political science and history, this paper explores how ju
Popular Abstract in English The present work deals with fracture in structures which are exposed to relatively few cycles of static loading during their life-time (maximum some ten thousand). Structures exposed to nearly monotonic loading are rare, except for such loaded mainly by their own weight. In spite of this fact, fracture mechanic methods developed for monotone loading are commonly used onThe experimental results presented confirm the anticipation that it is extremely important not to confuse the concept of 'static loading' with the one of 'monotonic loading'. In principle three different crack configurations were investigated in: edge-cracks, internal flaws and surface cracks. The results showed that the same calculation method could be used for all the investigated crack types. T
Popular Abstract in Swedish Funktionen hos hemoglobin från ryggradslösa organismer är mer varierande än motsvarande för ryggradsdjur, vilket möjligen speglar de mer mångfasetterade behoven inom den förra gruppen. Hemoglobin har strukturella likheter med andra hemproteiner/enzymer och uppvisar även överlappande enzymaktiviteter, med funktioner utöver transport och lagring av syre. Under syrefattigThe function of non-vertebrate haemoglobins (Hbs) appears more diverse than that of vertebrate Hbs, possibly reflecting the various demands to be met among their hosts. Sharing structural features with other haem proteins/enzymes, Hbs display a qualitative overlap in activities with functions extending beyond oxygen transport/storage. When subjected to oxygen deficient conditions, the obligate ae
Many birds and mammals show substantial circadian variation in body temperature, which has been attributed to fluctuations in ambient temperature and energy reserves. However, to fully understand the variation in body temperature over the course of the day, we also need to consider effects of variation in work rate. We made use of a dataset on body temperature during the resting and active periodsMany birds and mammals show substantial circadian variation in body temperature, which has been attributed to fluctuations in ambient temperature and energy reserves. However, to fully understand the variation in body temperature over the course of the day, we also need to consider effects of variation in work rate. We made use of a dataset on body temperature during the resting and active periods
Det terrestra ekosystemet absorberar cirka en tredjedel av de antropogena utsläppen varje år, vilket är en avgörande ekosystemtjänst som minskar ökningstakten av atmosfärisk koldioxid och bidrar till att mildra klimatförändringen. Observerade koncentrationer av atmosfäriskt koldioxid uppvisar en stor årlig variabilitet som främst anses vara orsakad av det terrestra ekosystemets respons på klimatföThe terrestrial ecosystem sequesters about one-third of anthropogenic emissions each year, thereby providing a critical ecosystem service that slows the rate of increase of atmospheric carbon dioxide and helps mitigate climate change. Observed atmospheric carbon dioxide concentrations exhibit a large inter-annual variability which is considered to be caused primarily by the response of the terrest
Purpose: To address the systematic bias in whole-brain dual flip angle (DFA) T1-mapping at 7T by optimizing the flip angle pair and carefully selecting RF pulse shape and duration. Theory and Methods: Spoiled gradient echoes can be used to estimate whole-brain maps of T1. This can be accomplished by using only two acquisitions with different flip angles, i.e., a DFA-based approach. Although DFA-ba
Facing increasing pressure to decarbonize, innovation within the shipping sector has turned to low-and zero carbon solutions. In this paper we investigate how the development and implementation of biodiesel and liquefied biogas (LBG) in Norwegian coastal shipping has been influenced by the technological alignment with fossil fuels. We understand this influence to emanate from the (mis)match of bioFacing increasing pressure to decarbonize, innovation within the shipping sector has turned to low-and zero carbon solutions. In this paper we investigate how the development and implementation of biodiesel and liquefied biogas (LBG) in Norwegian coastal shipping has been influenced by the technological alignment with fossil fuels. We understand this influence to emanate from the (mis)match of bio
Using qualitative content analysis on adverse drug reactions reports filed to an open Internet-based reporting system in Sweden, this study explored patients’ and consumers’ experiences of antidepressant treatment and the medical encounter. By scrutinizing free text comments in 181 individual consumer reports of adverse drug reactions, we could obtain important information about how people, as indUsing qualitative content analysis on adverse drug reactions reports filed to an open Internet-based reporting system in Sweden, this study explored patients’ and consumers’ experiences of antidepressant treatment and the medical encounter. By scrutinizing free text comments in 181 individual consumer reports of adverse drug reactions, we could obtain important information about how people, as ind
Regulation of development and entry into sporulation is critical for fungi to ensure survival of unfavorable environmental conditions. Here we present an analysis of gene sets regulating sporulation in the homothallic ascomycete Ashbya gossypii. Deletion of components of the conserved pheromone/starvation MAP kinase cascades, e.g., STE11 and STE7, results in increased sporulation. In kar3 mutants
The German bread market is considered one of the most developed and diverse bread markets worldwide. However, until so far no empirical evidence exists with respect to consumers liking and willingness to pay for different value-added attributes in whole grain bread. Thus, our study is the first one providingempirical evidence on how German consumers perceive different value-added attributes in whoThe German bread market is considered one of the most developed and diverse bread markets worldwide. However, until so far no empirical evidence exists with respect to consumers liking and willingness to pay for different value-added attributes in whole grain bread. Thus, our study is the first one providing empirical evidence on how German consumers perceive different value-added attributes in wh
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
Språk och litteraturcentrum, vårterminen 2018 Har du aktiverat ditt studentkonto? Aktivera ditt Studentkonto på https://passport.lu.se med hjälp av inloggningsuppgifterna från antagning.se. Studentkontot behöver du för att till exempel komma åt undervisningsplattformen, trådlösa nätverk och studentmejl. Om du redan har ett aktivt konto behöver du inte aktivera det igen. Logga in på studentportal
https://www.sol.lu.se/media/utbildning/dokument/kurser/LATA03/20181/V_lkomstbrev_VT18_LATA03.docx - 2026-08-17
Kurslitteratur för ENGG10 Engelska: Valbar kurs, 7,5 högskolepoäng, VT2026 Fastställd av styrelsen för Sektion 4, 2021-12-09 Obligatorisk kurslitteratur Litteraturen till dessa kurser varierar från termin till termin. Aktuella litteraturlistor tillhandahålls av respektive lärare. OBLIGATORISKA HJÄLPMEDEL The Oxford English Dictionary (online-version).1 Norstedts engelska ordbok – professionell (27
https://www.sol.lu.se/media/utbildning/dokument/kurser/ENGG10/20261/ENGG10_VT2026.pdf - 2026-08-17
Kurslitteratur för ENGG20 Engelsk språkvetenskap, 7,5 högskolepoäng, VT2026 Fastställd av styrelsen för Sektion 4, 2021-12-09 Obligatorisk kurslitteratur: Enligt lärares anvisningar. OBLIGATORISKA HJÄLPMEDEL (gäller alla delkurser) The Oxford English Dictionary (online-version).1 Norstedts engelska ordbok – professionell (276 000 ord och fraser). Engelsk- svensk/Svensk-engelsk. ISBN: 978-91-1-3022
https://www.sol.lu.se/media/utbildning/dokument/kurser/ENGG20/20261/ENGG20_VT2026.pdf - 2026-08-17
Microsoft Word - SVED01Praktikbrev23.docx Språk- och litteraturcentrum Praktikkurs i Svenska/Nordiska språk PRAKTIKBREV Språk- och litteraturcentrum ger två praktikkurser i ämnena svenska/nordiska språk. Kurserna kan sökas av studenter som tidigare läst svenska eller nordiska språk i minst 3 terminer (till exempel inom Språkkonsultprogrammet). Kurserna innebär att studenten under en termin alterna
https://www.sol.lu.se/media/utbildning/dokument/kurser/SVED11/20262/SVED11_12_Praktikbrev_april_2026.pdf - 2026-08-17
Ansökan om förlängning av doktorandanställning på grund av ledighet och uppdrag Efter den tilldelade anställningstiden – som för de flesta doktorander är 4 år – kan doktorandanställningen förlängas om det finns särskilda skäl, såsom: · sjukskrivning[footnoteRef:1] [1: Ledighet som måste vara registrerad och godkänd i Primula för att kunna utgöra grund till förlängning. ] · föräldraledighet1 · vård
Litteraturlista FTUA21 - VT26 Sida 1 av 2 Filosofiska institutionen LITTERATURLISTA VT2026 FTUA21, Teoretisk filosofi: Kritisk utredare – Fortsättningskurs, 30 hp Fastställd av Filosofiska institutionens studierektor 2025-11-24 Delkurs 1 – Kunskapsteori (7,5 hp) Bernecker, Sven & Dretske, Fred I.: Knowledge – Readings in Contemporary Epistemology, Oxford University Press, 2000. Olsson, Erik J: Kun
https://www.fil.lu.se/media/utbildning/dokument/kurser/FTUA21/20261/Litteraturlista_FTUA21_VT2026.pdf - 2026-08-18
2 ÖRESUNDSREGIONEN SOM PRIORITERING PÅ LUNDS UNIVERSITET? FÖRFATTARE Christer Eldh, universitetslektor vid Institutionen för service management och tjänstevetenskap, Lunds universitet Elin Fredriksson, studentmedarbetare vid Centrum för Öresundsstudier, Lunds universitet Markus Idvall, föreståndare för Centrum för Öresundsstudier, Lunds universitet, 2018–2019 Innehåll INLEDNING 3 METOD OCH MATERIA
https://www.cors.lu.se/sites/cors.lu.se/files/rapport_oresundsregionen_lu.pdf - 2026-08-18
