Filtyp
KURSPLAN Dnr 1(3) M 2013/582 Fastställd av NRU 2009-05-26 Gäller från 2009-07-01 Reviderad 2013-04-10, gäller från 2013-07-01 Reviderad 2016-05-02, gäller från 2016-07-01 AUDN72 Vetenskapsmetodik I Scientific Methodology I 6 högskolepoäng Nivå A1N Termin 7/ Master Allmänna uppgifter Huvudområde Audiologi / psykologi / lingvistik Typ av kurs Kursen ingår i audiologiutbildningen, 240 högskolepoäng o
https://www.student.med.lu.se/sites/student.med.lu.se/files/kursplaner.pdf - 2026-08-20
VETENSKAP OCH BEPRÖVAD ERFARENHET SOCIALTJÄNST VETENSKAP OCH BEPRÖVAD ERFARENHET VID SBU | 1 2 | STEN ANTTILA & SUSANNA AXELSSON VETENSKAP OCH BEPRÖVAD ERFARENHET SOCIALTJÄNST ISBN 978-91-983575-6-1 © VBE programmet och författarna Grafisk form Johan Laserna Tryckt av Media-Tryck, Lunds universitet, Lund 2019 Förord 9 NILS-ERIC SAHLIN Funktionsnedsättning: Lite vetenskap men har vi beprövad erfare
https://www.vbe.lu.se/sites/vbe.lu.se/files/vbe_socialtjanst_inlaga_issuu.pdf - 2026-08-20
VETENSKAP OCH BEPRÖVAD ERFARENHET SKOLA 2 | STEN ANTTILA & SUSANNA AXELSSON VETENSKAP OCH BEPRÖVAD ERFARENHET SKOLA ISBN 978-91-983575-2-3 © VBE programmet och författarna Grafisk form Johan Laserna Tryckt av Media-Tryck, Lunds universitet, Lund 2017 Förord 7 NILS-ERIC SAHLIN Forskningsbasering för god skolutveckling 9 EVA MINTEN Undervisning på vetenskaplig grund 19 LENA ADAMSON Skolutveckling på
https://www.vbe.lu.se/sites/vbe.lu.se/files/vbe_skola_for_webb.pdf - 2026-08-20
Manifest för en bättre ljudmiljö A 5 version II.indd manifest för en bättre ljudmiljö Manifestet antaget av Kungl. Musikaliska Akademiens styrelse den 8 februari 1995 Skrifter från Lyssnande Lund Ljudmiljöcentrum vid Lunds universitet MANIFEST Lunds universitet 2006 för en bättre l judmil jö manifest för en bättre ljudmiljö Manifestet antaget av Kungl. Musikaliska Akademiens styrelse den 8 februar
https://www.lmc.lu.se/sites/lmc.lu.se/files/2021-08/manifest_for_en_battre_ljudmiljo.pdf - 2026-08-20
Årshögtid Lunds universitet | 29 januari 2016 4 ÅRSHÖGTID 5ÅRSHÖGTID Program Årshögtid 29 januari 2016 Produktion: Akademiintendenturen vid Lunds universitet. Layout: Gunilla Albertén, Media-Tryck. Foto: sidan 1, 2 och 27: Kennet Ruona; sidan 7: Gunnar Menander. Upplaga: 600 ex. Tryck: Media-Tryck, Lund 2016 Procession Tyleman Susato: La Mourisque Lunds universitets brassband Tal av rektor Profess
https://www.lu.se/sites/www.lu.se/files/arshogtiden_-2016.pdf - 2026-08-20
1 H THumaniora & Teologi Pedagogisk inspirationskonferens för ht-områdets lärare 21 september 2010 TEXTKOMPENDIUM 2 FÖRORD: Förord ..................................................................................................................................................................................... 3 av Lynn Åkesson - Dekanus område humaniora och teologi, Lunds universitet. PROGRAM: P
Problemområde: De svenska kommunerna har fått ett ökat ansvar för samhällets beredskap gentemot olika krissituationer. En del i kommunens beredskap är arbetet med förberedande krisinformation till olika grupper i samhället, vilken är viktig för att människor ska agera på ett så bra och rationellt sätt som möjligt i en krissituation. En informationskanal som ständigt växer och utnyttjas av allt fle
Popular Abstract in English In the modern world of today, we are surrounded with many electronic devices which offer previously unseen performance. These devices constitute a large part of the everyday consumer electronics such as laptops, tablets, smart phones, etc., but are also used in wide variety of domains such as automotive industry, avionics, medicine, etc. The constant demand for high perIncreasing soft error rates in recent semiconductor technologies enforce the usage of fault tolerance. While fault tolerance enables correct operation in the presence of soft errors, it usually introduces a time overhead. The time overhead is particularly important for a group of computer systems referred to as real-time systems (RTSs) where correct operation is defined as producing the correct re
Det terrestra ekosystemet absorberar cirka en tredjedel av de antropogena utsläppen varje år, vilket är en avgörande ekosystemtjänst som minskar ökningstakten av atmosfärisk koldioxid och bidrar till att mildra klimatförändringen. Observerade koncentrationer av atmosfäriskt koldioxid uppvisar en stor årlig variabilitet som främst anses vara orsakad av det terrestra ekosystemets respons på klimatföThe terrestrial ecosystem sequesters about one-third of anthropogenic emissions each year, thereby providing a critical ecosystem service that slows the rate of increase of atmospheric carbon dioxide and helps mitigate climate change. Observed atmospheric carbon dioxide concentrations exhibit a large inter-annual variability which is considered to be caused primarily by the response of the terrest
Proteins are large, complex molecules that play many critical roles in the body and are required for the structure, function, and regulation of the body’s tissues and organs. In very simple terms, a protein can be defined as a linear chain of subunits called amino acid residues. The individual amino acid residues are sequentially bonded together by peptide bonds. There are 20 standard amino acids This work is primarily about the development, validation and application of computer simulation models for intrinsically disordered proteins, both in solution and in the presence of uniformly charged, ideal surfaces. The models in question are either coarse-grained or atomistic in nature, and their applications are dependent on the specific purpose of each study. Both, Metropolis Monte Carlo and m
Type 2 diabetes is one of the world’s major challenges today. Over 400 million people around the globe are diagnosed with diabetes and the consequences to the individual patient and health care systems are significant. Diabetes is a chronic disease and the standard treatment including lifestyle changes, metformin and insulin is in many cases not effective enough. New anti-diabetic drugs have been Type 2 diabetes is one of the world’s major challenges today. Over 400 million people around the globe are diagnosed with diabetes and the consequences to the individual patient and health care systems are significant. Diabetes is a chronic disease and the standard treatment including lifestyle changes, metformin and insulin is in many cases not effective enough. New anti-diabetic drugs have been
Regulation of development and entry into sporulation is critical for fungi to ensure survival of unfavorable environmental conditions. Here we present an analysis of gene sets regulating sporulation in the homothallic ascomycete Ashbya gossypii. Deletion of components of the conserved pheromone/starvation MAP kinase cascades, e.g., STE11 and STE7, results in increased sporulation. In kar3 mutants
The German bread market is considered one of the most developed and diverse bread markets worldwide. However, until so far no empirical evidence exists with respect to consumers liking and willingness to pay for different value-added attributes in whole grain bread. Thus, our study is the first one providingempirical evidence on how German consumers perceive different value-added attributes in whoThe German bread market is considered one of the most developed and diverse bread markets worldwide. However, until so far no empirical evidence exists with respect to consumers liking and willingness to pay for different value-added attributes in whole grain bread. Thus, our study is the first one providing empirical evidence on how German consumers perceive different value-added attributes in wh
High concentrations of salts in agricultural soils are an environmental problem that has plagued human civilization from its very beginning. Already the earliest civilizations in ancient Mesopotamia struggled with increasing concentrations of salt on irrigated fields. Also in modern times, salinization of soils, particularly of agricultural soils is still a problem restricting agricultural productSoil salinization is a pressing agricultural problem in many areas of the world, particularly in areas heavily reliant on irrigation agriculture. While the negative effects of salinity on crop plants have been widely studied, its effects on soil microorganisms have received less attention, and the impact of soil salinity on both microbial community structure and functioning is not well understood.
Using qualitative content analysis on adverse drug reactions reports filed to an open Internet-based reporting system in Sweden, this study explored patients’ and consumers’ experiences of antidepressant treatment and the medical encounter. By scrutinizing free text comments in 181 individual consumer reports of adverse drug reactions, we could obtain important information about how people, as indUsing qualitative content analysis on adverse drug reactions reports filed to an open Internet-based reporting system in Sweden, this study explored patients’ and consumers’ experiences of antidepressant treatment and the medical encounter. By scrutinizing free text comments in 181 individual consumer reports of adverse drug reactions, we could obtain important information about how people, as ind
Popular Abstract in Swedish POPULÄRVETENSKAPLIG SAMMANFATTNING (Popularized summary in Swedish) Monoaminer Monoaminer såsom serotonin, dopamin, noradrenalin, adrenalin och histamin är alla signalsubstanser syntetiserade från enkla aminosyror. Nervceller som innehåller monoaminer är anatomiskt lokaliserade till hjärnstammen och förlängda märgen. Härifrån försörjer de resten av storhjärnan samt ryIn the present study, the mRNA encoding the serotonin transporter (5-HTT) and two isoforms of the vesicular monoamine transporters (VMAT1 and VMAT2) have been mapped in the rat throughout gestation and early postnatal development using in situ hybridization, RT PCR and immunohistochemistry. 5-HTT mRNA was found in serotonergic neurons and VMAT2 mRNA in all monoaminergic neurons from early gestatio
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
