Sökresultat

https://www.intramed.lu.se/sites/intramed.lu.se/files/2022-12/allman-studieplan-klinisk-medicin-2015-01-01.pdf - 2026-10-21

https://www.ekonomiwebben.lu.se/sites/ekonomiwebben.lu.se/files/2024-05/universitet-och-hogskolor-andring-20240523-inkl-bilaga-1.pdf - 2026-10-21

Lunds universitets budgetunderlag för budgetåren 2022-2024 LUNDS UNIVERSITET | DNR STYR 2020/2001 | Beslut 2021-02-17 Lunds universitets budgetunderlag till regeringen 2022 – 2024 Innehållsförteckning Sammanfattning ................................................................................................................ 1 Bakgrund och förutsättningar ........................................

https://www.ekonomiwebben.lu.se/sites/ekonomiwebben.lu.se/files/2021-04/lunds-universitets-budgetunderlag-2022-2024.pdf - 2026-10-21

https://www.fageltaxering.lu.se/sites/fageltaxering.lu.se/files/2024-01/protokollstandard.xls - 2026-10-21

https://www.medarbetarwebben.lu.se/sites/medarbetarwebben.lu.se/files/rs-beslut-170127-170330.pdf - 2026-10-21

1 VERKSAMHETSPLAN FÖR MEDICINSKA FAKULTETEN 2023 Diarienr STYR 2022/2316 2 3 Innehåll 1 Inledning ............................................................................................................................ 5 2 Universitetets och fakultetens omvärld .............................................................................. 6 2.1 Den politiska inriktningen ......................

https://www.intramed.lu.se/sites/intramed.lu.se/files/2023-02/2023%20VP%20o%20RF%20o%20Bil%20Tryckversion.pdf - 2026-10-21

Brevmall Rektor Diarieföring i universitetsgemensamt system Bakgrund 1993 beslutade rektor om regler för diarieföring och ordnande av handlingar vid institutioner (dnr I A33 8513/93). I beslutet anges att allmänna handlingar ska diarieföras eller hållas ordnade på annat sätt. Däremot finns inga anvisningar som säger hur detta ska göras i praktiken. Idag har förutsättningarna för diarieföring och ä

https://www.medarbetarwebben.lu.se/sites/medarbetarwebben.lu.se/files/diarieforing-universitetsgemensamt-system.pdf - 2026-10-21

Styrelsen | Sacoråd Göteborgs Stad Hoppa till huvudinnehåll Öppna sökruta Öppna Huvudmeny Sök på saco.se Om oss In English Vår vision Styrelsen Kalendarium Våra förbund Akavia DIK Naturvetarna SRAT Sveriges Ingenjörer Sveriges Arbetsterapeuter Sveriges Arkitekter Sveriges Psykologförbund Sveriges Skolledare Presentation av lokalföreningen ' Skolledningsnytt ' Arbetsmiljö och skyddsorganisation Arb

https://www.saco.se/fortroendevald/lokalt-fackligt-arbete/lokala-akademikerforeningar/kommun-region/centrala-sacoradet-i-goteborgs-stad/Om-oss/Styrelsen/ - 2026-10-20

Löneskola 2026 | Akademikerföreningen vid Siemens Energy AB Hoppa till huvudinnehåll Öppna sökruta Öppna Huvudmeny Sök på saco.se Om oss Stadgar Kollektivavtal Bli medlem Nyheter Nyhetsbrev Kaffekampanj Presentation "Will I be poor when I retire" Löneskola 2026 Lecture "Swedish pension system", 15th of April 11:45 Lecture "Working in Sweden" 16th of December Presentationsmaterialet från pensionsfö

https://www.saco.se/fortroendevald/lokalt-fackligt-arbete/lokala-akademikerforeningar/privat/akademikerforeningen-vid-siemens-i-finspang/nyheter/loneskola/ - 2026-10-20

https://www.teddy.lu.se/sites/teddy.lu.se/files/07312014_1972_swedish_book_3_will_emma.pdf - 2026-10-21

https://www.sasnet.lu.se/sites/sasnet.lu.se/files/lu_strategy_report_2011.pdf - 2026-10-21

LUM Lunds universitets magasin | Nr 2 | 2011 omsvärmad LU startar stiftelse i USA Klassfrågan het igen... 2 LUM nr 2 | 2011 1947 års kvinna Ovan: Ett tidigt självporträtt (1943) som Randi Fisher gav bort i lysningspresent till sin syster Else inför giftermålet med Ingmar Bergman. Till höger: En vävd kormatta som lånats av Askersunds församling (1955). En detaljskiss till teaterridån i Medborgarhus

https://www.lu.se/sites/www.lu.se/files/lunds-universitets-magasin-2-2011.pdf - 2026-10-21

https://www.soclaw.lu.se/anna-lundberg - 2026-10-23

There is a lack of objective evaluative standards for academic work. While this has been recognized in studies of how gatekeepers pass judgment on the works of others, little is known about how scholars deal with the uncertainty about how their work will be evaluated by gatekeepers. Building upon 35 interviews with early career academics in political science and history, this paper explores how juThere is a lack of objective evaluative standards for academic work. While this has been recognized in studies of how gatekeepers pass judgment on the works of others, little is known about how scholars deal with the uncertainty about how their work will be evaluated by gatekeepers. Building upon 35 interviews with early career academics in political science and history, this paper explores how ju

Using qualitative content analysis on adverse drug reactions reports filed to an open Internet-based reporting system in Sweden, this study explored patients’ and consumers’ experiences of antidepressant treatment and the medical encounter. By scrutinizing free text comments in 181 individual consumer reports of adverse drug reactions, we could obtain important information about how people, as indUsing qualitative content analysis on adverse drug reactions reports filed to an open Internet-based reporting system in Sweden, this study explored patients’ and consumers’ experiences of antidepressant treatment and the medical encounter. By scrutinizing free text comments in 181 individual consumer reports of adverse drug reactions, we could obtain important information about how people, as ind

Facing increasing pressure to decarbonize, innovation within the shipping sector has turned to low-and zero carbon solutions. In this paper we investigate how the development and implementation of biodiesel and liquefied biogas (LBG) in Norwegian coastal shipping has been influenced by the technological alignment with fossil fuels. We understand this influence to emanate from the (mis)match of bioFacing increasing pressure to decarbonize, innovation within the shipping sector has turned to low-and zero carbon solutions. In this paper we investigate how the development and implementation of biodiesel and liquefied biogas (LBG) in Norwegian coastal shipping has been influenced by the technological alignment with fossil fuels. We understand this influence to emanate from the (mis)match of bio

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

The standard method used for tagging b-hadrons in the DELPHI experiment at the CERN LEP Collider is discussed in detail. The main ingredient of b-tagging is the impact parameters of tracks, which relies mostly on the vertex detector. Additional information, such as the mass of particles associated to a secondary vertex, significantly improves the selection efficiency and the background suppression

Popular Abstract in Swedish Bangladesh är ett av världens folkrikaste muslimska länder. Sedan självständigheten har invånarna – trots politisk oro, massiva naturkatastrofer och utbredd administrativ korruption – upplevt en positiv utveckling, särskilt vad gäller kvinnors utbildning, hälsovård och familjeplanering. Denna avhandling diskuterar kvinnors levnadsförhållanden på landsbygden med fokus påBangladesh is one of the largest Muslim countries in the world. In spite of political turmoil, frequent natural disasters and widespread corruption it has, in less than four decades after its birth as an independent state, gained visible success in human development - especially the education of women and girls, family planning and health, and microcredit to the poor. As a Muslim country it has s

Problemområde: De svenska kommunerna har fått ett ökat ansvar för samhällets beredskap gentemot olika krissituationer. En del i kommunens beredskap är arbetet med förberedande krisinformation till olika grupper i samhället, vilken är viktig för att människor ska agera på ett så bra och rationellt sätt som möjligt i en krissituation. En informationskanal som ständigt växer och utnyttjas av allt fle