Filetype
Adherence by Helicobacter pylori increases the risk of gastric disease. Here, we report that more than 95% of strains that bind fucosylated blood group antigen bind A, B, and O antigens (generalists), whereas 60% of adherent South American Amerindian strains bind blood group O antigens best (specialists). This specialization coincides with the unique predominance of blood group O in these Amerindi
Many studies have over the years utilized gravity models derived from trade theories to investigate how various factors affect trade in agricultural goods. Although technological improvements could be considered in such models, few studies have considered this topic in depth, leaving a void to fill. To partly fill this void, this study has chosen the silk sector to analyze the impact of technologi
Problemområde: De svenska kommunerna har fått ett ökat ansvar för samhällets beredskap gentemot olika krissituationer. En del i kommunens beredskap är arbetet med förberedande krisinformation till olika grupper i samhället, vilken är viktig för att människor ska agera på ett så bra och rationellt sätt som möjligt i en krissituation. En informationskanal som ständigt växer och utnyttjas av allt fle
As technology progress the right to personal integrity has been discussed in several areas. One of those areas is labour law and specifically the employee’s right to personal integrity. As communication becomes more and more digital it has become more practical for employers to monitor their employees. The question regarding employees’ right to protection for their personal integrity is, despite
Gamma ray spectroscopy of neutron deficient nuclei close to the doubly magic nucleus Sn-100 has been performed using a heavy-ion reaction and the NORDBALL Ge-detector array. Evaporation residues were identified by means of charged particle and neutron detection. Transitions in 31 different evaporation residues were identified. New results on Cd-102 are presented.
Popular Abstract in Swedish Bangladesh är ett av världens folkrikaste muslimska länder. Sedan självständigheten har invånarna – trots politisk oro, massiva naturkatastrofer och utbredd administrativ korruption – upplevt en positiv utveckling, särskilt vad gäller kvinnors utbildning, hälsovård och familjeplanering. Denna avhandling diskuterar kvinnors levnadsförhållanden på landsbygden med fokus påBangladesh is one of the largest Muslim countries in the world. In spite of political turmoil, frequent natural disasters and widespread corruption it has, in less than four decades after its birth as an independent state, gained visible success in human development - especially the education of women and girls, family planning and health, and microcredit to the poor. As a Muslim country it has s
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
HAMLET is a complex of α-lactalbumin (α-LA) with oleic acid (OA) that selectively kills tumor cells and Streptococcus pneumoniae. To assess the contribution of the proteinaceous component to cytotoxicity of HAMLET, OA complexes with proteins structurally and functionally distinct from α-LA were prepared. Similar to HAMLET, the OA complexes with bovine β-lactoglobulin (bLG) and pike parvalbumin (pP
There is a lack of objective evaluative standards for academic work. While this has been recognized in studies of how gatekeepers pass judgment on the works of others, little is known about how scholars deal with the uncertainty about how their work will be evaluated by gatekeepers. Building upon 35 interviews with early career academics in political science and history, this paper explores how juThere is a lack of objective evaluative standards for academic work. While this has been recognized in studies of how gatekeepers pass judgment on the works of others, little is known about how scholars deal with the uncertainty about how their work will be evaluated by gatekeepers. Building upon 35 interviews with early career academics in political science and history, this paper explores how ju
Measurements of fetal aortic blood flow velocity and fetal growth were performed in 178 pregnancies. In 87 cases, the estimated fetal weight was > 2 SD below the gestational age-related mean of the population. Three fetuses died in utero. In 148 children (84%) an assessment of overall intellectual ability was performed at 6.5 years of age. Verbal and global IQ was lower in the group with an abnorm
Facing increasing pressure to decarbonize, innovation within the shipping sector has turned to low-and zero carbon solutions. In this paper we investigate how the development and implementation of biodiesel and liquefied biogas (LBG) in Norwegian coastal shipping has been influenced by the technological alignment with fossil fuels. We understand this influence to emanate from the (mis)match of bioFacing increasing pressure to decarbonize, innovation within the shipping sector has turned to low-and zero carbon solutions. In this paper we investigate how the development and implementation of biodiesel and liquefied biogas (LBG) in Norwegian coastal shipping has been influenced by the technological alignment with fossil fuels. We understand this influence to emanate from the (mis)match of bio
BACKGROUND AND PURPOSE: Myeloablative Total Body Irradiation (TBI) is an important modality in conditioning for allogeneic hematopoietic stem cell transplantation (HSCT), especially in children with high-risk acute lymphoblastic leukemia (ALL). TBI practices are heterogeneous and institution-specific. Since TBI is associated with multiple late adverse effects, recommendations may help to standardi
A number of species have recently recovered from near-extinction. Although these species have avoided the immediate extinction threat, their long-term viability remains precarious due to the potential genetic consequences of population declines, which are poorly understood on a timescale beyond a few generations. Woolly mammoths (Mammuthus primigenius) became isolated on Wrangel Island around 10,0
Established in 2015, the Multi-Stakeholder Engagement (MuSE) Consortium is an international network of over 120 individuals interested in stakeholder engagement in research and guidelines. The MuSE group is developing guidance for stakeholder engagement in the development of health and healthcare guideline development. The development of this guidance has included multiple meetings with stakeholde
BACKGROUND: Quantifying bone mineral density (BMD) on CT using commercial software demonstrates good-to-excellent correlations with dual-energy x-ray absorptiometry (DEXA) results. However, previous techniques to measure Hounsfield units (HUs) within the proximal femur demonstrate less successful correlation with DEXA results. An effective method of measuring HUs of the proximal femur from CT colo
Inhibiting ADP-ribosyl transferases with PARP-inhibitors is considered a promising strategy for the treatment of many cancers and ischemia, but most of the cellular targets are poorly characterized. Here, we describe an inhibitor of ADP-ribosyltransferase-3/poly(ADP-ribose) polymerase-3 (ARTD3), a regulator of DNA repair and mitotic progression. In vitro profiling against 12 members of the enzyme
A high quality benchmark for small variants encompassing 88 to 90% of the reference genome has been developed for seven Genome in a Bottle (GIAB) reference samples. However a reliable benchmark for large indels and structural variants (SVs) is yet to be defined. In this study, we manually curated 1235 SVs which can ultimately be used to evaluate SV callers ortrain machine learning models. We devel
BACKGROUND: Larotrectinib is a first-in-class, highly selective tropomyosin receptor kinase (TRK) inhibitor approved to treat adult and pediatric patients with TRK fusion-positive cancer. The aim of this study was to evaluate the efficacy and safety of larotrectinib in patients with TRK fusion-positive primary central nervous system (CNS) tumors.METHODS: Patients with TRK fusion-positive primary C
BACKGROUND: Cytoreductive surgery and hyperthermic intraperitoneal chemotherapy (CRS-HIPEC) is the preferred treatment of peritoneal carcinomatosis (PC) of colorectal carcinoma. Patients with positive lymph node status have worse survival after CRS-HIPEC, which is probably due to higher rates of systemic failure. In this study, we analysed the effect of administration and timing of systemic chemot
The endeavour to align the goals of the Swedish food strategy with the national environmental quality objectives and the 17 global SDGs, presents an extraordinary challenge that calls for systemic innovation. Industrial symbiosis can potentially provide the means for increasing sustainable food production, using locally sub-exploited resources that can reduce the need for land, agrochemicals, tran
