Filetype
https://www.saco.se/globalassets/lokala-akademikerforeningar/kommun-och-region/goteborgs-stad/dokument/facklig-foretradare/sveriges-skolledares-dokument/self-determination-theory-and-the-facilitation-of-intrinsic-motivation-social-development-and-well-being.pdf https://www.saco.se/globalassets/lokala-akademikerforeningar/kommun-och-region/goteborgs-stad/dokument/facklig-foretradare/sveriges-skolle
BACKGROUND: Understanding the molecular biology of colorectal cancer (CRC) provides opportunities for effective personalised patient management. We evaluated whether chromosomal aberrations, mutations in the PI(3)K signalling pathway and the CpG-island methylator phenotype (CIMP) in primary colorectal tumours can predict liver metastases.METHODS: Formalin-fixed paraffin-embedded material from prim
This study explores how scientists navigate research topic transitions during their early-career training and examines its impact on the production of novel knowledge. Drawing on survey data of 270 mid-career scientists in life sciences, we investigate their time investment in topics during early career stages (i.e. during PhD and postdoc training) and trace their research output for 15 years afte
Recently the Intergovernmental Panel on Climate Change released their 6th Assessment reports which confirm that the impact of climate change is visible, e.g. through an increased weather volatility leading both to hotter drier weather and increased flooding in some regions globally. One clear example of this is the increased prevalence of wildfires in recent years and increasing wildfire potential
BACKGROUND: Pancreatic cancer presents as advanced disease in >80% of patients; yet, appropriate ages to consider prevention and early detection strategies are poorly defined. We investigated age-specific associations and attributable risks of pancreatic cancer for established modifiable and non-modifiable risk factors.PATIENTS AND METHODS: We included 167 483 participants from two prospective US
OBJECTIVES: Pancreatic ductal adenocarcinoma (PDAC) is a highly lethal disease that is challenging to detect at an early stage. Biomarkers are needed that can detect PDAC early in the course of disease when interventions lead to the best outcomes. We highlight study design and statistical considerations that inform pancreatic cancer early detection biomarker evaluation.METHODS: We describe experim
A permanently available molecular-beam injection setup for controlled molecules (COMO) was installed and commissioned at the small quantum systems (SQS) instrument at the European x-ray free-electron laser (EuXFEL). A b-type electrostatic deflector allows for pure state-, size-, and isomer-selected samples of polar molecules and clusters. The source provides a rotationally cold (T ≈ 1 K) and dense
Tissue immunity and responses to injury depend on the coordinated action and communication among physiological systems. Here, we show that, upon injury, adaptive responses to the microbiota directly promote sensory neuron regeneration. At homeostasis, tissue-resident commensal-specific T cells colocalize with sensory nerve fibers within the dermis, express a transcriptional program associated with
The androgen receptor (AR) is central in prostate tissue identity and differentiation, and controls normal growth-suppressive, prostate-specific gene expression. It also drives prostate tumorigenesis when hijacked for oncogenic transcription. The execution of growth-suppressive AR transcriptional programs in prostate cancer (PCa) and the potential for reactivation remain unclear. Here, we use a ge
The status of our roads and the possibility to monitor the conditions of them are becoming more and more important due to the steady increase of vehicles populating them. This thesis aims to improve a system for which purpose is to gather data about the status of roads, which the Swedish company Klimator develops. With more frequently measured roads saltand plowing efforts could be optimized and i
Streptococcus pneumoniae resists host defenses through multiple surface factors, yet their specific contribution to protection against antimicrobial peptides remains incompletely understood. We examined the role of pneumococcal surface protein A (PspA) and the polysaccharide capsule in protection against the human defensin HNP-1. PspA conferred increased resistance to HNP-1-induced killing, show
Despite the success of antiretroviral therapy, a subset of people with HIV experience low-level viraemia (LLV), a challenging condition with inconsistent definitions and management across settings. We conducted a scoping review of the literature and developed international consensus recommendations through a modified Delphi process involving a multidisciplinary panel of experts. Available evidence
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
Objective: To evaluate under- and overreporting and their determinants in the EPIC :24-hour diet recall (24-HDR) measurements collected in the European Prospective Investigation into Cancer and Nutrition (EPIC). Design: Cross-sectional analysis. 24-HDR measurements were obtained by means of a standardised computerised interview program (EPIC-SOFT). The ratio of reported energy intake (EI) to estim
Popular Abstract in Swedish Bangladesh är ett av världens folkrikaste muslimska länder. Sedan självständigheten har invånarna – trots politisk oro, massiva naturkatastrofer och utbredd administrativ korruption – upplevt en positiv utveckling, särskilt vad gäller kvinnors utbildning, hälsovård och familjeplanering. Denna avhandling diskuterar kvinnors levnadsförhållanden på landsbygden med fokus påBangladesh is one of the largest Muslim countries in the world. In spite of political turmoil, frequent natural disasters and widespread corruption it has, in less than four decades after its birth as an independent state, gained visible success in human development - especially the education of women and girls, family planning and health, and microcredit to the poor. As a Muslim country it has s
Popular Abstract in English The present work deals with fracture in structures which are exposed to relatively few cycles of static loading during their life-time (maximum some ten thousand). Structures exposed to nearly monotonic loading are rare, except for such loaded mainly by their own weight. In spite of this fact, fracture mechanic methods developed for monotone loading are commonly used onThe experimental results presented confirm the anticipation that it is extremely important not to confuse the concept of 'static loading' with the one of 'monotonic loading'. In principle three different crack configurations were investigated in: edge-cracks, internal flaws and surface cracks. The results showed that the same calculation method could be used for all the investigated crack types. T
As technology progress the right to personal integrity has been discussed in several areas. One of those areas is labour law and specifically the employee’s right to personal integrity. As communication becomes more and more digital it has become more practical for employers to monitor their employees. The question regarding employees’ right to protection for their personal integrity is, despite
Popular Abstract in Swedish Funktionen hos hemoglobin från ryggradslösa organismer är mer varierande än motsvarande för ryggradsdjur, vilket möjligen speglar de mer mångfasetterade behoven inom den förra gruppen. Hemoglobin har strukturella likheter med andra hemproteiner/enzymer och uppvisar även överlappande enzymaktiviteter, med funktioner utöver transport och lagring av syre. Under syrefattigThe function of non-vertebrate haemoglobins (Hbs) appears more diverse than that of vertebrate Hbs, possibly reflecting the various demands to be met among their hosts. Sharing structural features with other haem proteins/enzymes, Hbs display a qualitative overlap in activities with functions extending beyond oxygen transport/storage. When subjected to oxygen deficient conditions, the obligate ae
IMPORTANCE: Luminal and basal subtypes of primary prostate cancer have been shown to be molecularly distinct and clinically important in predicting response to therapy. These subtypes have not been described in metastatic prostate cancer.OBJECTIVES: To identify clinical and molecular correlates of luminal and basal subtypes in metastatic castration-resistant prostate cancer (mCRPC) and investigate
Oxygen-enhanced MRI (OE-MRI) biomarkers have potential value in assessment of COPD, but need further evaluation before treatment-induced changes can be interpreted. The objective was to evaluate how OE-MRI parameters of regional ventilation and oxygen uptake respond to standard pharmacological interventions in COPD, and how the response compares to that of gold standard pulmonary function tests.
