Search results

Filter

Filetype

Your search for "*" yielded 558220 hits

Betydelsen av etnicitet: gestaltningar av ’de andra’ i samtal om otrygghet, kriminalitet och utsatthet för brott

Detta projekt uppmärksammar brottsoffer och etnicitetsfrågor. I fokus står mellanmänskliga tolkningar av etnicitetens betydelse. Syftet är att analysera etnicitetstillskrivningar hos ungdomar som blivit utsatta för rån eller misshandel av andra ungdomar ”med annan etnicitet”. Med samtalsintervjun som metod studeras hur etnicitet omtalas och behandlas. Innebörden av begreppet är inte entydig, det i

Nucleic Acids: Innovative Methods for Recovery, Clarification and Purification

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Homogenization of woven materials

The effective electric and magnetic material properties of a complex (twocomponent) mixture are addressed. The mixture is periodic in two directions and has a finite thickness in the third direction. Specifically,the explicit problem of finding the effective electric parameters for slab that has been reinforced by a layer (or several layers) of glass fiber is investigated. The homogenization probl

A Numerical Method for Design of PI Controllers

This paper presents an efficient numerical method to design PI controllers. The design is based on optimization of the load disturbance rejection, with constraints on the sensitivity and weighting of the set point response. Thus, the formulation of the design problem captures many aspects of industrial control problems. It leads to a nonconvex optimization problem. Efficient ways to solve the prob